| Facility | Hogwarts |
| Analyst | John Doe |
| Analysis started | 2025-04-03 05:19:03 |
| Analysis completed | 2025-04-03 05:19:03 |
| Wall time | 0:0:0 hours |
| locus | COI |
| preliminary_id | Muscidae |
| taxa_of_interest |
Atherigona orientalis |
| country | Vietnam |
| host | Dragon Fruit |
| sample_id | VE25-1406_COI |
| Query DNA sequence |
>VE25-1406_COI ATAAAGATATTGGTATTTTATATTTTATTTTTGGAATATGGTCAGGAATTATAGGAATAT CAATAAGAATAATTATTCGAATAGAATTAGGTAATCCAGGATCTTTAATTGGTAATGATC AAATTTATAATTCTATTGTTACAACTCATGCTTTTACAATAATTTTTTTTTTCGTTATAC CAGTAATAATAGGAGGATTTGGTAATTATTTTATTCCAATTATTTTAGGTATTCCCGATA TGGCTTTCCCTCGAATAAATAATATAAGATTTTGATTATTACCTCCAAGATTAATATTAT TAATTAGAAGAATATTTATTAGTACAGGTACAGGTACAGGTTGGACTGTTTATCCACCAT TATCATTAAATTTATCTCATAATGGACCTTCAGTTGATTTATCAATTTTTTCTTTACATT TAGCAGGTGTTAGATCAATTATAGGATCAGTTAATTTTATTACTACTATTTTAAATATAA AAATTAATAAATATGAAAATATTCCTTTATTAGCTTGGGCTTTATTACTTACAGCTATTT TATTACTATTATCTTTACCTGTACTTGCTGGAGCAATTACTATACTATTATTTGATCGAA ATTTAAATACATCTTTTTTTGATCCTGCAGGAGGTGGAGATCCTGTTTTATATCAACATT TATTTTGATTTTT
Inconclusive
The analyst should attempt subjective species identification at the genus level.
Reasoning - Flag 1D:
At least one candidate species matched with moderate stringency (identity ≥93.5% and <98.5%).
| Preliminary morphology ID confirmed | NA |
|
Inconclusive taxonomic identity (Flag 1D) |
|
| Taxa of interest ruled out | False |
|
Flag 2A: Taxon of interest NOT detected Flag 5.1A: The given locus for this taxon is well represented in reference database (>5 entries) Flag 5.2C: ≤10% of taxon have reference sequence(s) at the given locus |
|
Flag 1D:
The analyst should attempt subjective species identification at the genus level
At least one candidate species matched with moderate stringency (identity ≥93.5% and <98.5%)
Candidate hits must meet ONE of these criteria:
| Minimum alignment length |
400bp
|
| Minimum query coverage |
85.0%
|
Candidate hits are then classified as follows:
| Classification | Alignment identity | Number of hits | Number of species |
|---|---|---|---|
| STRONG MATCH | ≥ 98.5% | 0 | 0 |
| MODERATE MATCH | ≥ 93.5% | 4 | 2 |
| NO MATCH | < 93.5% |
Hits per candidate species (top 10 candidates only)
| Species | Hits | Identity | E-value |
|---|---|---|---|
| Pteromalidae sp. | 2 | 98.4% | 0.0 |
| Pachycrepoideus vindemmiae | 2 | 97.8% | 0.0 |
| # | Accession | Hit subject | Align length | Query coverage | Score | E-value | Identity |
|---|---|---|---|---|---|---|---|
| 1 | OQ134363 | Pteromalidae sp. voucher D83 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 569 | 84.5% | 542.0 | 0.00e+00 | 98.4% |
| 2 | OQ455486 | Pachycrepoideus vindemmiae voucher FZN 004 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 630 | 93.6% | 588.0 | 0.00e+00 | 97.8% |
| 3 | OQ134362 | Pteromalidae sp. voucher D58 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 546 | 81.1% | 504.0 | 0.00e+00 | 97.4% |
| 4 | OM956372 | Pachycrepoideus vindemmiae isolate cytochrome oxidase subunit 1 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 583 | 86.6% | 472.0 | 0.00e+00 | 93.7% |
| 5 | PP727399 | Pachycrepoideus vindemmiae strain hitman cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 652 | 96.9% | 520.0 | 0.00e+00 | 93.3% |
| 6 | MT712142 | Pachycrepoideus vindemmiae mitochondrion, partial genome | 673 | 100.0% | 517.0 | 0.00e+00 | 92.3% |
| 7 | MW441241 | Pachycrepoideus vindemmiae voucher PV-ETNA cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 626 | 93.0% | 476.0 | 0.00e+00 | 92.0% |
| 8 | MG506412 | Pteromalidae sp. BIOUG21319-A04 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 652 | 96.9% | 442.0 | 0.00e+00 | 89.3% |
| 9 | OK524222 | Lariophagus texanus voucher CNIN3707ROO cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 577 | 85.7% | 391.0 | 0.00e+00 | 89.3% |
| 10 | MG497519 | Pteromalidae sp. BIOUG21116-F11 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 621 | 92.3% | 414.0 | 0.00e+00 | 88.9% |
| 11 | GU675361 | Pteromalidae sp. BOLD:AAG1902 voucher MTCHA-0014 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 96.7% | 431.0 | 0.00e+00 | 88.7% |
| 12 | GU675362 | Pteromalidae sp. BOLD:AAG1902 voucher MTCHA-0019 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 96.7% | 429.0 | 0.00e+00 | 88.7% |
| 13 | OP498202 | Sycoscapter sp. 1 AYW-2022a voucher Sy1_micro_1 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 667 | 99.1% | 439.0 | 0.00e+00 | 88.6% |
| 14 | KR373083 | Pteromalinae sp. BOLD:ACM1146 voucher BIOUG12100-D01 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 607 | 90.2% | 402.0 | 0.00e+00 | 88.6% |
| 15 | MK155058 | Ophelimus sp. 1 RJH-2019 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 671 | 99.7% | 440.0 | 0.00e+00 | 88.5% |
| 16 | OP498214 | Sycoscapter sp. 1 AYW-2022a voucher Sy1_relig_4 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 667 | 99.1% | 436.0 | 0.00e+00 | 88.5% |
| 17 | KR892750 | Pteromalinae sp. BOLD-2016 voucher BIOUG07255-F10 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 96.7% | 426.0 | 0.00e+00 | 88.5% |
| 18 | OP498215 | Sycoscapter sp. 1 AYW-2022a voucher Sy1_relig_5 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 667 | 99.1% | 433.0 | 0.00e+00 | 88.3% |
| 19 | OP498216 | Sycoscapter sp. 1 AYW-2022a voucher Sy1_relig_6 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 667 | 99.1% | 433.0 | 0.00e+00 | 88.3% |
| 20 | KY836675 | Pteromalidae sp. BIOUG04746-G11 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 626 | 93.0% | 407.0 | 0.00e+00 | 88.3% |
| 21 | MW981983 | Lariophagus texanus voucher USNM:ENT:01566093 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 618 | 91.8% | 405.0 | 0.00e+00 | 88.3% |
| 22 | KR804532 | Pteromalinae sp. BOLD-2016 voucher BIOUG01285-H05 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 623 | 92.6% | 404.0 | 0.00e+00 | 88.3% |
| 23 | MK530739 | Micranisa sp. 3 AYW-2019 voucher Mi_curti_1 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 667 | 99.1% | 430.0 | 0.00e+00 | 88.2% |
| 24 | MG784020 | Pteromalus sp. A_HB voucher BC-ZSM-HYM-01772-D09 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 620 | 92.1% | 402.0 | 0.00e+00 | 88.2% |
| 25 | PP054243 | Micranisa claviscapa voucher NBAIR-200423 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 673 | 100.0% | 434.0 | 0.00e+00 | 88.1% |
| 26 | KM997077 | Hymenoptera sp. BOLD:AAU9445 voucher BIOUG02671-E12 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 621 | 92.3% | 399.0 | 0.00e+00 | 88.1% |
| 27 | OR600857 | Stictomischus sp. 1 MR-2023a voucher FRI/NFIC/23341 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 610 | 90.6% | 391.0 | 0.00e+00 | 88.1% |
| 28 | KR901071 | Pteromalidae sp. BOLD-2016 voucher 08BBHYM-0764 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 96.7% | 418.0 | 0.00e+00 | 88.0% |
| 29 | JN292661 | Pteromalinae sp. BBHYI799-10 voucher BIOUG| 651 |
96.7% |
417.0 |
0.00e+00 |
88.0% |
|
| 30 | KR803055 | Achrysocharoides cilla voucher BIOUG01285-B02 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 614 | 91.2% | 392.0 | 0.00e+00 | 88.0% |
| 31 | MG377939 | Pteromalidae sp. BIOUG23530-C07 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 607 | 90.2% | 388.0 | 0.00e+00 | 88.0% |
| 32 | MK530753 | Micranisa sp. 6 AYW-2019 voucher Mi_piso_2 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 667 | 99.1% | 424.0 | 0.00e+00 | 87.9% |
| 33 | KJ166673 | Pteromalidae sp. BOLD:ACC7754 voucher BIOUG03445-C07 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 652 | 96.9% | 415.0 | 0.00e+00 | 87.9% |
| 34 | JQ416999 | Cecidostiba fungosa isolate CFUN3018 cytochrome c oxidase subunit I gene, partial cds; mitochondrial | 651 | 96.7% | 414.0 | 0.00e+00 | 87.9% |
| 35 | MG784007 | Pteromalus aff. altus B_HB voucher BC-ZSM-HYM-01772-E04 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 96.7% | 414.0 | 0.00e+00 | 87.9% |
| 36 | JQ416984 | Cecidostiba fungosa isolate CFUN92 cytochrome c oxidase subunit I gene, partial cds; mitochondrial | 651 | 96.7% | 414.0 | 0.00e+00 | 87.9% |
| 37 | KM564952 | Pteromalidae sp. BOLD:ACG4086 voucher BIOUG05424-H04 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 96.7% | 414.0 | 0.00e+00 | 87.9% |
| 38 | JQ417026 | Cecidostiba fungosa isolate CFUN140 cytochrome c oxidase subunit I gene, partial cds; mitochondrial | 651 | 96.7% | 414.0 | 0.00e+00 | 87.9% |
| 39 | OR336228 | Pteromalus sp. voucher 10X00MS192021 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 644 | 95.7% | 410.0 | 0.00e+00 | 87.9% |
| 40 | MG375766 | Pteromalidae sp. BIOUG25540-A09 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 629 | 93.5% | 402.0 | 0.00e+00 | 87.9% |
| 41 | MG377470 | Pteromalidae sp. BIOUG25467-B08 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 629 | 93.5% | 401.0 | 0.00e+00 | 87.9% |
| 42 | KM559987 | Pteromalidae sp. BOLD:ACG4086 voucher BIOUG08427-G06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 626 | 93.0% | 398.0 | 0.00e+00 | 87.9% |
| 43 | OL538138 | Kaleva corynocera voucher SMNS_37212 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 647 | 96.1% | 410.0 | 0.00e+00 | 87.8% |
| 44 | KM564162 | Pteromalidae sp. BOLD:ACB2400 voucher BIOUG03533-D03 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 621 | 92.3% | 393.0 | 0.00e+00 | 87.8% |
| 45 | KM559971 | Pteromalidae sp. BOLD:ABY3906 voucher 10BBCHY-2943 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 621 | 92.3% | 393.0 | 0.00e+00 | 87.8% |
| 46 | KM555694 | Pteromalidae sp. BOLD:ACC9247 voucher BIOUG03592-D01 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 620 | 92.1% | 392.0 | 0.00e+00 | 87.8% |
| 47 | OP498184 | Sycoscapter sp. voucher Sy_glabe_2 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 667 | 99.1% | 421.0 | 0.00e+00 | 87.7% |
| 48 | MK530754 | Micranisa sp. 6 AYW-2019 voucher Mi_piso_3 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 667 | 99.1% | 421.0 | 0.00e+00 | 87.7% |
| 49 | KR891350 | Pteromalidae sp. BOLD-2016 voucher BIOUG00786-C03 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 652 | 96.9% | 412.0 | 0.00e+00 | 87.7% |
| 50 | KM556563 | Pteromalidae sp. BOLD:ACC6420 voucher BIOUG03235-B08 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 96.7% | 411.0 | 0.00e+00 | 87.7% |
| 51 | MG784035 | Pteromalus aff. altus B_HB voucher BC-ZSM-HYM-01772-E05 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 96.7% | 411.0 | 0.00e+00 | 87.7% |
| 52 | KR791471 | Pteromalinae sp. BOLD-2016 voucher BIOUG01280-A04 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 96.7% | 411.0 | 0.00e+00 | 87.7% |
| 53 | KM560656 | Pteromalidae sp. BOLD:ACG4086 voucher BIOUG05444-B10 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 96.7% | 411.0 | 0.00e+00 | 87.7% |
| 54 | KM557100 | Pteromalidae sp. BOLD:ACG4086 voucher BIOUG05444-A03 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 96.7% | 411.0 | 0.00e+00 | 87.7% |
| 55 | JN300904 | Hymenoptera sp. BOLD:AAU9905 voucher BIOUG| 651 |
96.7% |
411.0 |
0.00e+00 |
87.7% |
|
| 56 | KR891271 | Pteromalinae sp. BOLD-2016 voucher BIOUG07938-H08 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 96.7% | 411.0 | 0.00e+00 | 87.7% |
| 57 | KM560455 | Hymenoptera sp. BOLD:ACD0275 voucher BIOUG04139-H06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 96.7% | 411.0 | 0.00e+00 | 87.7% |
| 58 | JQ416992 | Cecidostiba fungosa isolate CFUN2969 cytochrome c oxidase subunit I gene, partial cds; mitochondrial | 651 | 96.7% | 411.0 | 0.00e+00 | 87.7% |
| 59 | JQ416991 | Cecidostiba fungosa isolate CFUN98 cytochrome c oxidase subunit I gene, partial cds; mitochondrial | 651 | 96.7% | 411.0 | 0.00e+00 | 87.7% |
| 60 | KR784657 | Achrysocharoides cilla voucher BIOUG01284-E11 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 650 | 96.6% | 410.0 | 0.00e+00 | 87.7% |
| 61 | JQ083697 | Aphytis chrysomphali isolate Ach_27 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 673 | 100.0% | 421.0 | 0.00e+00 | 87.6% |
| 62 | JQ083699 | Aphytis chrysomphali isolate Ach_29 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 673 | 100.0% | 421.0 | 0.00e+00 | 87.6% |
| 63 | JQ083698 | Aphytis chrysomphali isolate Ach_28 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 673 | 100.0% | 421.0 | 0.00e+00 | 87.6% |
| 64 | JQ083700 | Aphytis chrysomphali isolate Ach_30 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 673 | 100.0% | 421.0 | 0.00e+00 | 87.6% |
| 65 | JQ083695 | Aphytis chrysomphali isolate Ach_25 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 673 | 100.0% | 421.0 | 0.00e+00 | 87.6% |
| 66 | MK530742 | Micranisa sp. 4 AYW-2019 voucher Mi_macle_3 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 667 | 99.1% | 418.0 | 0.00e+00 | 87.6% |
| 67 | MK530746 | Micranisa sp. 5 AYW-2019 voucher Mi_micro_1 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 667 | 99.1% | 418.0 | 0.00e+00 | 87.6% |
| 68 | KM566015 | Pteromalidae sp. BOLD:AAU9905 voucher BIOUG06519-C01 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 96.7% | 409.0 | 0.00e+00 | 87.6% |
| 69 | OL538079 | Kaleva corynocera voucher SMNS_37915 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 96.7% | 408.0 | 0.00e+00 | 87.6% |
| 70 | OL538102 | Atrichomalus trianellatus voucher SMNS_38112 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 96.7% | 408.0 | 0.00e+00 | 87.6% |
| 71 | OP443461 | Trichogramma sp. voucher YT-235 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 96.7% | 408.0 | 0.00e+00 | 87.6% |
| 72 | OP443469 | Trichogramma sp. voucher YT-240 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 96.7% | 408.0 | 0.00e+00 | 87.6% |
| 73 | JQ417013 | Cecidostiba fungosa isolate CFUN69 cytochrome c oxidase subunit I gene, partial cds; mitochondrial | 651 | 96.7% | 408.0 | 0.00e+00 | 87.6% |
| 74 | OP443542 | Trichogramma sp. voucher YT-225 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 96.7% | 408.0 | 0.00e+00 | 87.6% |
| 75 | JQ416988 | Cecidostiba fungosa isolate CFUN116 cytochrome c oxidase subunit I gene, partial cds; mitochondrial | 651 | 96.7% | 408.0 | 0.00e+00 | 87.6% |
| 76 | KR797374 | Pteromalinae sp. BOLD-2016 voucher BIOUG01330-F07 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 96.7% | 408.0 | 0.00e+00 | 87.6% |
| 77 | MF956204 | Pseudotorymus napi voucher GDEL3028 cytochrome oxidase subunit I gene, partial cds; mitochondrial | 651 | 96.7% | 408.0 | 0.00e+00 | 87.6% |
| 78 | KR797724 | Pteromalidae sp. BOLD-2016 voucher BIOUG01258-D12 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 96.7% | 408.0 | 0.00e+00 | 87.6% |
| 79 | MG382058 | Pteromalidae sp. BIOUG24154-F11 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 96.7% | 408.0 | 0.00e+00 | 87.6% |
| 80 | KM556014 | Pteromalidae sp. BOLD:ACG4086 voucher BIOUG05465-C05 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 96.7% | 408.0 | 0.00e+00 | 87.6% |
| 81 | JQ416983 | Cecidostiba fungosa isolate CFUN2967 cytochrome c oxidase subunit I gene, partial cds; mitochondrial | 651 | 96.7% | 408.0 | 0.00e+00 | 87.6% |
| 82 | JQ416982 | Cecidostiba fungosa isolate CFUN87 cytochrome c oxidase subunit I gene, partial cds; mitochondrial | 651 | 96.7% | 408.0 | 0.00e+00 | 87.6% |
| 83 | KR791333 | Pteromalidae sp. BOLD-2016 voucher BIOUG01037-E07 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 96.7% | 408.0 | 0.00e+00 | 87.6% |
| 84 | OP443522 | Trichogramma sp. voucher YT-204 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 96.7% | 408.0 | 0.00e+00 | 87.6% |
| 85 | JQ416989 | Cecidostiba fungosa isolate CFUN3511 cytochrome c oxidase subunit I gene, partial cds; mitochondrial | 651 | 96.7% | 408.0 | 0.00e+00 | 87.6% |
| 86 | JQ417012 | Cecidostiba fungosa isolate CFUN66 cytochrome c oxidase subunit I gene, partial cds; mitochondrial | 651 | 96.7% | 408.0 | 0.00e+00 | 87.6% |
| 87 | OP443526 | Trichogramma sp. voucher YT-208 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 96.7% | 408.0 | 0.00e+00 | 87.6% |
| 88 | JQ416987 | Cecidostiba fungosa isolate CFUN86 cytochrome c oxidase subunit I gene, partial cds; mitochondrial | 651 | 96.7% | 408.0 | 0.00e+00 | 87.6% |
| 89 | JQ416996 | Cecidostiba fungosa isolate CFUN2897 cytochrome c oxidase subunit I gene, partial cds; mitochondrial | 651 | 96.7% | 408.0 | 0.00e+00 | 87.6% |
| 90 | MG374232 | Pteromalidae sp. BIOUG23892-C09 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 96.7% | 408.0 | 0.00e+00 | 87.6% |
| 91 | MW784386 | Lyrcus sp. BBP-285 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 643 | 95.5% | 403.0 | 0.00e+00 | 87.6% |
| 92 | KM562729 | Cecidostiba sp. BOLD:AAU9512 voucher 10BBCHY-0409 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 636 | 94.5% | 399.0 | 0.00e+00 | 87.6% |
| 93 | JQ268915 | Aphytis aonidiae isolate UG-Z18 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 667 | 99.1% | 415.0 | 0.00e+00 | 87.5% |
| 94 | OP443534 | Trichogramma sp. voucher YT-216 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 96.7% | 405.0 | 0.00e+00 | 87.5% |
| 95 | OP443527 | Trichogramma sp. voucher YT-024 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 96.7% | 405.0 | 0.00e+00 | 87.5% |
| 96 | OP443466 | Trichogramma sp. voucher YT-233 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 96.7% | 405.0 | 0.00e+00 | 87.5% |
| 97 | OP443456 | Trichogramma sp. voucher YT-232 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 96.7% | 405.0 | 0.00e+00 | 87.5% |
| 98 | OP443493 | Trichogramma sp. voucher YT-175 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 96.7% | 405.0 | 0.00e+00 | 87.5% |
| 99 | OP443470 | Trichogramma sp. voucher YT-241 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 96.7% | 405.0 | 0.00e+00 | 87.5% |
| 100 | MG382308 | Pteromalidae sp. BIOUG31088-A10 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 630 | 93.6% | 393.0 | 0.00e+00 | 87.5% |
| 101 | KR801934 | Pteromalidae sp. BOLD-2016 voucher BIOUG02507-H06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 626 | 93.0% | 392.0 | 0.00e+00 | 87.5% |
| 102 | KM566407 | Pteromalidae sp. BOLD:ABZ9561 voucher BIOUG04095-A03 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 629 | 93.5% | 392.0 | 0.00e+00 | 87.5% |
| 103 | JQ083696 | Aphytis chrysomphali isolate Ach_26 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 673 | 100.0% | 418.0 | 0.00e+00 | 87.4% |
| 104 | MW167116 | Walkerella microcarpae mitochondrion, partial genome | 673 | 100.0% | 418.0 | 0.00e+00 | 87.4% |
| 105 | ON704785 | Pteromalidae sp. isolate J5 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 673 | 100.0% | 418.0 | 0.00e+00 | 87.4% |
| 106 | JQ083701 | Aphytis sp. 2 BSM-2012 isolate Asp2_147b cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 673 | 100.0% | 418.0 | 0.00e+00 | 87.4% |
| 107 | MH521285 | Acroclisoides solus isolate 2017/23 cytochrome c oxidase subunit I (COI) gene, partial cds; mitochondrial | 673 | 100.0% | 418.0 | 0.00e+00 | 87.4% |
| 108 | MK530749 | Micranisa sp. 5 AYW-2019 voucher Mi_micro_5 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 667 | 99.1% | 416.0 | 0.00e+00 | 87.4% |
| 109 | MK530740 | Micranisa sp. 4 AYW-2019 voucher Mi_macle_1 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 667 | 99.1% | 415.0 | 0.00e+00 | 87.4% |
| 110 | KM559925 | Hymenoptera sp. BOLD:ACD0275 voucher BIOUG04050-C08 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 96.7% | 407.0 | 0.00e+00 | 87.4% |
| 111 | MG500337 | Pteromalidae sp. BIOUG21116-D07 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 96.7% | 406.0 | 0.00e+00 | 87.4% |
| 112 | JQ417015 | Cecidostiba fungosa isolate CFUN72 cytochrome c oxidase subunit I gene, partial cds; mitochondrial | 651 | 96.7% | 405.0 | 0.00e+00 | 87.4% |
| 113 | JN292242 | Pteromalidae sp. BBHYI107-10 voucher BIOUG| 651 |
96.7% |
405.0 |
0.00e+00 |
87.4% |
|
| 114 | JQ416986 | Cecidostiba fungosa isolate CFUN2900 cytochrome c oxidase subunit I gene, partial cds; mitochondrial | 651 | 96.7% | 405.0 | 0.00e+00 | 87.4% |
| 115 | KM564211 | Pteromalidae sp. BOLD:ACB0475 voucher BIOUG03359-F11 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 96.7% | 405.0 | 0.00e+00 | 87.4% |
| 116 | KM557211 | Philotrypesis sp. BOLD:ABY3426 voucher BIOUG05500-A01 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 96.7% | 405.0 | 0.00e+00 | 87.4% |
| 117 | JQ417000 | Cecidostiba fungosa isolate CFUN3026 cytochrome c oxidase subunit I gene, partial cds; mitochondrial | 651 | 96.7% | 405.0 | 0.00e+00 | 87.4% |
| 118 | PP495366 | Lyrcus perdubius voucher Lype-0020 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 96.7% | 405.0 | 0.00e+00 | 87.4% |
| 119 | JQ416995 | Cecidostiba fungosa isolate CFUN97 cytochrome c oxidase subunit I gene, partial cds; mitochondrial | 651 | 96.7% | 405.0 | 0.00e+00 | 87.4% |
| 120 | JQ417005 | Cecidostiba fungosa isolate CFUN81 cytochrome c oxidase subunit I gene, partial cds; mitochondrial | 651 | 96.7% | 405.0 | 0.00e+00 | 87.4% |
| 121 | MG497651 | Pteromalidae sp. BIOUG21600-G12 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 96.7% | 405.0 | 0.00e+00 | 87.4% |
| 122 | MG380860 | Pteromalidae sp. BARS_2016_26_155 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 96.7% | 405.0 | 0.00e+00 | 87.4% |
| 123 | KM568712 | Pteromalidae sp. BOLD:ACC1508 voucher BIOUG03697-F09 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 96.7% | 405.0 | 0.00e+00 | 87.4% |
| 124 | JQ417018 | Cecidostiba fungosa isolate CFUN74 cytochrome c oxidase subunit I gene, partial cds; mitochondrial | 651 | 96.7% | 405.0 | 0.00e+00 | 87.4% |
| 125 | OL538065 | Pteromalus altus voucher SMNS_39299 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 96.7% | 405.0 | 0.00e+00 | 87.4% |
| 126 | KR800054 | Pteromalidae sp. BOLD-2016 voucher BIOUG01037-A02 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 644 | 95.7% | 401.0 | 0.00e+00 | 87.4% |
| 127 | MG513416 | Pteromalidae sp. BIOUG10408-B03 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 628 | 93.3% | 397.0 | 0.00e+00 | 87.4% |
| 128 | KM556849 | Pteromalidae sp. BOLD:AAM7430 voucher BIOUG06357-G06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 627 | 93.2% | 391.0 | 0.00e+00 | 87.4% |
| 129 | MG340007 | Eulophidae sp. BIOUG23058-A04 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 625 | 92.9% | 388.0 | 0.00e+00 | 87.4% |
| 130 | MG946790 | Metaphycus flavus isolate 03 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 670 | 99.6% | 415.0 | 0.00e+00 | 87.3% |
| 131 | MG946791 | Metaphycus flavus isolate 06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 670 | 99.6% | 415.0 | 0.00e+00 | 87.3% |
| 132 | MK530752 | Micranisa sp. 6 AYW-2019 voucher Mi_piso_1 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 667 | 99.1% | 412.0 | 0.00e+00 | 87.3% |
| 133 | MK530756 | Micranisa sp. 6 AYW-2019 voucher Mi_piso_5 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 667 | 99.1% | 412.0 | 0.00e+00 | 87.3% |
| 134 | OP498177 | Sycoscapter sp. voucher Sy_annu_1 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 667 | 99.1% | 412.0 | 0.00e+00 | 87.3% |
| 135 | OP498092 | Philotrypesis sp. voucher Ph_orthon_2 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 667 | 99.1% | 412.0 | 0.00e+00 | 87.3% |
| 136 | MK530744 | Micranisa sp. 4 AYW-2019 voucher Mi_macle_5 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 667 | 99.1% | 412.0 | 0.00e+00 | 87.3% |
| 137 | OP498199 | Sycoscapter sp. 1 AYW-2022a voucher Sy1_macle_4 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 667 | 99.1% | 412.0 | 0.00e+00 | 87.3% |
| 138 | OP498123 | Philotrypesis sp. 2 AYW-2022a voucher Ph2_glabe_5 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 667 | 99.1% | 412.0 | 0.00e+00 | 87.3% |
| 139 | MG499525 | Pteromalidae sp. BIOUG08991-C05 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 96.7% | 403.0 | 0.00e+00 | 87.3% |
| 140 | MG376826 | Pteromalidae sp. BIOUG24652-H02 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 652 | 96.9% | 403.0 | 0.00e+00 | 87.3% |
| 141 | KM557387 | Pteromalidae sp. BOLD:ACC1508 voucher BIOUG04166-E12 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 96.7% | 403.0 | 0.00e+00 | 87.3% |
| 142 | KR806533 | Cecidostiba sp. BOLD-2016 voucher BIOUG01599-G11 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 96.7% | 402.0 | 0.00e+00 | 87.3% |
| 143 | MG337297 | Eulophidae sp. BIOUG24493-B12 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 96.7% | 402.0 | 0.00e+00 | 87.3% |
| 144 | MN681066 | Pteromalidae sp. BOLD:AAN7620 voucher CHARS00063-B10 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 648 | 96.3% | 402.0 | 0.00e+00 | 87.3% |
| 145 | JQ417008 | Cecidostiba fungosa isolate CFUN75 cytochrome c oxidase subunit I gene, partial cds; mitochondrial | 651 | 96.7% | 402.0 | 0.00e+00 | 87.3% |
| 146 | KM561743 | Pteromalidae sp. BOLD:ACG4430 voucher BIOUG05353-H05 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 96.7% | 402.0 | 0.00e+00 | 87.3% |
| 147 | JQ416990 | Cecidostiba fungosa isolate CFUN2955 cytochrome c oxidase subunit I gene, partial cds; mitochondrial | 651 | 96.7% | 402.0 | 0.00e+00 | 87.3% |
| 148 | JQ417003 | Cecidostiba fungosa isolate CFUN79 cytochrome c oxidase subunit I gene, partial cds; mitochondrial | 651 | 96.7% | 402.0 | 0.00e+00 | 87.3% |
| 149 | KM569306 | Pteromalidae sp. BOLD:ACB0475 voucher BIOUG03359-E02 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 96.7% | 402.0 | 0.00e+00 | 87.3% |
| 150 | JQ417004 | Cecidostiba fungosa isolate CFUN68 cytochrome c oxidase subunit I gene, partial cds; mitochondrial | 651 | 96.7% | 402.0 | 0.00e+00 | 87.3% |
| 151 | KM567998 | Pteromalidae sp. BOLD:ACB0475 voucher BIOUG03332-H07 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 96.7% | 402.0 | 0.00e+00 | 87.3% |
| 152 | MG380992 | Cecidostiba sp. BIOUG22002-A04 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 96.7% | 402.0 | 0.00e+00 | 87.3% |
| 153 | KU641120 | Pteromalus venustus isolate 4786-PTV-bc cytochrome oxidase subunit 1 (cox1) gene, partial cds; mitochondrial | 651 | 96.7% | 402.0 | 0.00e+00 | 87.3% |
| 154 | OP443516 | Trichogramma sp. voucher YT-198 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 96.7% | 402.0 | 0.00e+00 | 87.3% |
| 155 | KR898157 | Pteromalus sp. BOLD-2016 voucher BIOUG07356-C08 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 96.7% | 402.0 | 0.00e+00 | 87.3% |
| 156 | KM557178 | Pteromalinae sp. BOLD:ACD0964 voucher BIOUG03482-D03 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 96.7% | 402.0 | 0.00e+00 | 87.3% |
| 157 | MN669034 | Pteromalidae sp. BOLD:AAN7620 voucher CHARS00063-C07 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 647 | 96.1% | 401.0 | 0.00e+00 | 87.3% |
| 158 | MN678548 | Pteromalidae sp. BOLD:AAN7620 voucher CHARS00192-H06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 645 | 95.8% | 399.0 | 0.00e+00 | 87.3% |
| 159 | MF905142 | Eurytomidae sp. BIOUG14374-D05 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 629 | 93.5% | 389.0 | 0.00e+00 | 87.3% |
| 160 | OP498204 | Sycoscapter sp. 1 AYW-2022a voucher Sy1_micro_3 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 667 | 99.1% | 409.0 | 0.00e+00 | 87.2% |
| 161 | MG337501 | Eulophidae sp. BIOUG27519-D04 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 96.7% | 399.0 | 0.00e+00 | 87.2% |
| 162 | MN678472 | Pteromalidae sp. BOLD:AAN7620 voucher CHARS00194-H02 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 648 | 96.3% | 399.0 | 0.00e+00 | 87.2% |
| 163 | KR788665 | Pteromalidae sp. BOLD-2016 voucher BIOUG01018-D10 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 96.7% | 399.0 | 0.00e+00 | 87.2% |
| 164 | KR896027 | Eulophidae sp. BOLD-2016 voucher BIOUG08035-F04 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 648 | 96.3% | 399.0 | 0.00e+00 | 87.2% |
| 165 | MN683355 | Pteromalidae sp. BOLD:ACE1279 voucher CHARS00281-D03 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 648 | 96.3% | 399.0 | 0.00e+00 | 87.2% |
| 166 | MN667490 | Pachyneuron groenlandicum voucher CHARS00157-A06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 648 | 96.3% | 399.0 | 0.00e+00 | 87.2% |
| 167 | MN683394 | Pteromalidae sp. BOLD:ACE1279 voucher CHARS00259-D05 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 648 | 96.3% | 399.0 | 0.00e+00 | 87.2% |
| 168 | OP443543 | Trichogramma sp. voucher YT-226 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 96.7% | 399.0 | 0.00e+00 | 87.2% |
| 169 | OP443528 | Trichogramma sp. voucher YT-023 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 96.7% | 399.0 | 0.00e+00 | 87.2% |
| 170 | MN677161 | Pteromalidae sp. BOLD:ADU0204 voucher CHARS00256-D01 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 647 | 96.1% | 398.0 | 0.00e+00 | 87.2% |
| 171 | MN670101 | Pteromalidae sp. BOLD:ACE1279 voucher CHARS00263-E04 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 647 | 96.1% | 398.0 | 0.00e+00 | 87.2% |
| 172 | MN683070 | Pteromalidae sp. BOLD:ACE1279 voucher CHARS00142-D11 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 647 | 96.1% | 398.0 | 0.00e+00 | 87.2% |
| 173 | KM501054 | Trichogramma achaeae isolate Ta9 cytochrome oxidase subunit I (CO1) gene, partial cds; mitochondrial | 637 | 94.7% | 391.0 | 0.00e+00 | 87.2% |
| 174 | MW789210 | Trichogramma chilonis mitochondrion, complete genome | 673 | 100.0% | 412.0 | 0.00e+00 | 87.1% |
| 175 | MT712144 | Trichogramma chilonis mitochondrion, complete genome | 673 | 100.0% | 412.0 | 0.00e+00 | 87.1% |
| 176 | MK530755 | Micranisa sp. 6 AYW-2019 voucher Mi_piso_4 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 667 | 99.1% | 409.0 | 0.00e+00 | 87.1% |
| 177 | OP498218 | Sycoscapter sp. 1 AYW-2022a voucher Sy1_stric_1 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 667 | 99.1% | 409.0 | 0.00e+00 | 87.1% |
| 178 | KR894501 | Eulophidae sp. BOLD-2016 voucher BIOUG07701-C07 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 96.7% | 399.0 | 0.00e+00 | 87.1% |
| 179 | KR892893 | Pteromalidae sp. BOLD-2016 voucher BIOUG07357-E08 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 96.7% | 399.0 | 0.00e+00 | 87.1% |
| 180 | KR798639 | Cecidostiba sp. BOLD-2016 voucher BIOUG01598-H08 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 96.7% | 399.0 | 0.00e+00 | 87.1% |
| 181 | MN395436 | Acroclisoides sinicus voucher Acro1 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 651 | 96.7% | 399.0 | 0.00e+00 | 87.1% |
| 182 | KY837644 | Eulophidae sp. BIOUG04901-E10 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 96.7% | 399.0 | 0.00e+00 | 87.1% |
| 183 | HQ929634 | Pteromalidae sp. BOLD:AAN7689 voucher BIOUG| 651 |
96.7% |
399.0 |
0.00e+00 |
87.1% |
|
| 184 | KM561797 | Pteromalidae sp. BOLD:ACB0475 voucher BIOUG03332-D05 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 96.7% | 399.0 | 0.00e+00 | 87.1% |
| 185 | KM561389 | Pteromalidae sp. BOLD:ACB0475 voucher BIOUG03273-G08 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 96.7% | 399.0 | 0.00e+00 | 87.1% |
| 186 | KR783553 | Cecidostiba sp. BOLD-2016 voucher BIOUG01115-C02 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 96.7% | 399.0 | 0.00e+00 | 87.1% |
| 187 | MH456778 | Metaphycus flavus voucher 25015 cytochrome c oxidase subunit I (COI) gene, partial cds; mitochondrial | 651 | 96.7% | 399.0 | 0.00e+00 | 87.1% |
| 188 | KM560327 | Pteromalidae sp. BOLD:ACC1567 voucher BIOUG03697-H09 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 650 | 96.6% | 399.0 | 0.00e+00 | 87.1% |
| 189 | MN413503 | Acroclisoides sinicus voucher AcKo0101 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 651 | 96.7% | 399.0 | 0.00e+00 | 87.1% |
| 190 | HQ929599 | Pteromalidae sp. BOLD:AAN7689 voucher BIOUG| 651 |
96.7% |
399.0 |
0.00e+00 |
87.1% |
|
| 191 | MH456780 | Metaphycus flavus voucher 25033 cytochrome c oxidase subunit I (COI) gene, partial cds; mitochondrial | 651 | 96.7% | 399.0 | 0.00e+00 | 87.1% |
| 192 | MK188331 | Acroclisoides solus voucher Acso-0005 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 96.7% | 399.0 | 0.00e+00 | 87.1% |
| 193 | KM561434 | Pteromalidae sp. BOLD:ACD3866 voucher BIOUG04241-E09 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 96.7% | 399.0 | 0.00e+00 | 87.1% |
| 194 | KM565922 | Philotrypesis sp. BOLD:AAU9140 voucher 10BBCHY-1625 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 650 | 96.6% | 398.0 | 0.00e+00 | 87.1% |
| 195 | MN678115 | Pteromalidae sp. BOLD:ACE1279 voucher CHARS00142-B05 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 648 | 96.3% | 396.0 | 0.00e+00 | 87.1% |
| 196 | MN676123 | Pteromalidae sp. BOLD:ACE1279 voucher CHARS00095-F01 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 648 | 96.3% | 396.0 | 0.00e+00 | 87.1% |
| 197 | MN666521 | Pteromalidae sp. BOLD:ADS2745 voucher CHARS00035-A06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 648 | 96.3% | 396.0 | 0.00e+00 | 87.1% |
| 198 | MG499909 | Pteromalidae sp. BIOUG20249-C06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 642 | 95.4% | 393.0 | 0.00e+00 | 87.1% |
| 199 | JQ756549 | Diaziella sp. nov. 11 ex Ficus sumatrana voucher 1877_08 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 632 | 93.9% | 390.0 | 0.00e+00 | 87.1% |
| 200 | MK530766 | Walkerella nigrabdomina voucher Wa_pisoc_4 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 637 | 94.7% | 388.0 | 0.00e+00 | 87.1% |
| 201 | JQ083702 | Aphytis sp. 2 BSM-2012 isolate Asp2_146b cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 673 | 100.0% | 409.0 | 0.00e+00 | 87.0% |
| 202 | NC_039535 | Trichogramma ostriniae mitochondrion, complete genome | 673 | 100.0% | 409.0 | 0.00e+00 | 87.0% |
| 203 | PQ059861 | Citrostichus phyllocnistoides mitochondrion, complete genome | 673 | 100.0% | 409.0 | 0.00e+00 | 87.0% |
| 204 | OP498115 | Philotrypesis sp. 1 AYW-2022a voucher Ph1_pisoc_4 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 667 | 99.1% | 406.0 | 0.00e+00 | 87.0% |
| 205 | OP498091 | Philotrypesis sp. voucher Ph_orthon_1 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 667 | 99.1% | 406.0 | 0.00e+00 | 87.0% |
| 206 | OP498182 | Sycoscapter sp. voucher Sy_glabe_1_1 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 667 | 99.1% | 406.0 | 0.00e+00 | 87.0% |
| 207 | KM557039 | Pteromalidae sp. BOLD:ACC1508 voucher BIOUG04165-H06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 96.7% | 401.0 | 0.00e+00 | 87.0% |
| 208 | KF573375 | Trichogramma pretiosum isolate 2A cytochrome c oxidase subunit I (COI) gene, partial cds; mitochondrial | 652 | 96.9% | 397.0 | 0.00e+00 | 87.0% |
| 209 | MG340920 | Eulophidae sp. BIOUG24542-F09 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 652 | 96.9% | 397.0 | 0.00e+00 | 87.0% |
| 210 | MG376895 | Pteromalidae sp. BIOUG23774-A01 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 652 | 96.9% | 397.0 | 0.00e+00 | 87.0% |
| 211 | KF573376 | Trichogramma pretiosum isolate 3A cytochrome c oxidase subunit I (COI) gene, partial cds; mitochondrial | 652 | 96.9% | 397.0 | 0.00e+00 | 87.0% |
| 212 | MK611830 | Trichogramma chilonis isolate CHI10 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 652 | 96.9% | 397.0 | 0.00e+00 | 87.0% |
| 213 | JN300905 | Hymenoptera sp. BOLD:AAU4878 voucher BIOUG| 652 |
96.9% |
397.0 |
0.00e+00 |
87.0% |
|
| 214 | MG343509 | Tetrastichinae sp. BIOUG24493-F09 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 652 | 96.9% | 397.0 | 0.00e+00 | 87.0% |
| 215 | KP994548 | Trichogramma achaeae voucher CUTA 03-A1 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 651 | 96.7% | 396.0 | 0.00e+00 | 87.0% |
| 216 | KY838796 | Pteromalidae sp. BIOUG02546-F03 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 96.7% | 396.0 | 0.00e+00 | 87.0% |
| 217 | KR879145 | Eulophidae sp. BOLD-2016 voucher BIOUG07970-D07 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 96.7% | 396.0 | 0.00e+00 | 87.0% |
| 218 | MN667214 | Pachyneuron groenlandicum voucher CHARS00120-H08 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 648 | 96.3% | 396.0 | 0.00e+00 | 87.0% |
| 219 | OP443478 | Trichogramma sp. voucher YT-086 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 96.7% | 396.0 | 0.00e+00 | 87.0% |
| 220 | MF906123 | Eulophidae sp. BIOUG21324-A01 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 96.7% | 396.0 | 0.00e+00 | 87.0% |
| 221 | OL538058 | Kaleva corynocera voucher SMNS_38626 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 96.7% | 396.0 | 0.00e+00 | 87.0% |
| 222 | OP443517 | Trichogramma sp. voucher YT-199 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 96.7% | 396.0 | 0.00e+00 | 87.0% |
| 223 | JN300310 | Hymenoptera sp. BOLD:AAU9867 voucher BIOUG| 651 |
96.7% |
396.0 |
0.00e+00 |
87.0% |
|
| 224 | JN300311 | Hymenoptera sp. BOLD:AAU9867 voucher BIOUG| 651 |
96.7% |
396.0 |
0.00e+00 |
87.0% |
|
| 225 | MH456723 | Metaphycus flavus voucher 23795 cytochrome c oxidase subunit I (COI) gene, partial cds; mitochondrial | 651 | 96.7% | 396.0 | 0.00e+00 | 87.0% |
| 226 | JN300308 | Hymenoptera sp. BOLD:AAU9867 voucher BIOUG| 651 |
96.7% |
396.0 |
0.00e+00 |
87.0% |
|
| 227 | KY843834 | Eulophidae sp. BIOUG04902-H11 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 96.7% | 396.0 | 0.00e+00 | 87.0% |
| 228 | KR883929 | Pteromalidae sp. BOLD-2016 voucher BIOUG07357-B11 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 96.7% | 396.0 | 0.00e+00 | 87.0% |
| 229 | OP443530 | Trichogramma sp. voucher YT-014 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 96.7% | 396.0 | 0.00e+00 | 87.0% |
| 230 | KR795047 | Pteromalidae sp. BOLD-2016 voucher BIOUG01017-C03 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 96.7% | 396.0 | 0.00e+00 | 87.0% |
| 231 | MN395442 | Acroclisoides sinicus voucher Acro36 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 651 | 96.7% | 396.0 | 0.00e+00 | 87.0% |
| 232 | KF444823 | Pteromalus sp. AAF-2013 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 651 | 96.7% | 396.0 | 0.00e+00 | 87.0% |
| 233 | MN666065 | Pteromalidae sp. BOLD:AAN7620 voucher CHARS00046-B12 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 647 | 96.1% | 395.0 | 0.00e+00 | 87.0% |
| 234 | MN675192 | Pachyneuron groenlandicum voucher CHARS00261-F06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 647 | 96.1% | 395.0 | 0.00e+00 | 87.0% |
| 235 | MN677833 | Pteromalidae sp. BOLD:ACE1279 voucher CHARS00281-C08 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 647 | 96.1% | 395.0 | 0.00e+00 | 87.0% |
| 236 | MN679208 | Pteromalidae sp. BOLD:ACE1279 voucher CHARS00141-G03 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 647 | 96.1% | 395.0 | 0.00e+00 | 87.0% |
| 237 | OQ272751 | Pteromalidae sp. voucher 07000MS082021 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 647 | 96.1% | 395.0 | 0.00e+00 | 87.0% |
| 238 | OL538112 | Toxeuma discretum voucher SMNS_38763 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 645 | 95.8% | 393.0 | 0.00e+00 | 87.0% |
| 239 | KR786723 | Pteromalidae sp. BOLD-2016 voucher BIOUG01601-B12 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 648 | 96.3% | 393.0 | 0.00e+00 | 87.0% |
| 240 | MG374787 | Pteromalidae sp. BIOUG22003-A02 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 639 | 94.9% | 390.0 | 0.00e+00 | 87.0% |
| 241 | LC260604 | Aphelinus varipes mitochondrial COX1 gene for cytochrome c oxidase subunit 1, partial cds, isolate: Av000038 | 673 | 100.0% | 409.0 | 0.00e+00 | 86.9% |
| 242 | PP111119 | Sycoscapter sp. voucher NBAIR-280423 A cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 670 | 99.6% | 409.0 | 0.00e+00 | 86.9% |
| 243 | OP498207 | Sycoscapter sp. 1 AYW-2022a voucher Sy1_micro_6 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 667 | 99.1% | 403.0 | 0.00e+00 | 86.9% |
| 244 | KJ087727 | Pteromalidae sp. BOLD:AAZ5701 voucher BIOUG03336-B06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 96.7% | 397.0 | 0.00e+00 | 86.9% |
| 245 | MG500841 | Pteromalidae sp. BIOUG21382-G10 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 96.7% | 396.0 | 0.00e+00 | 86.9% |
| 246 | MG500222 | Pteromalidae sp. BIOUG21209-B12 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 96.7% | 396.0 | 0.00e+00 | 86.9% |
| 247 | KJ089078 | Pteromalidae sp. BOLD:AAZ5701 voucher BIOUG03445-F03 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 96.7% | 396.0 | 0.00e+00 | 86.9% |
| 248 | KR784169 | Cecidostiba sp. BOLD-2016 voucher BIOUG01598-H04 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 96.7% | 396.0 | 0.00e+00 | 86.9% |
| 249 | JQ416985 | Cecidostiba fungosa isolate CFUN3027 cytochrome c oxidase subunit I gene, partial cds; mitochondrial | 651 | 96.7% | 396.0 | 0.00e+00 | 86.9% |
| 250 | KX053433 | Hymenoptera sp. sc_07997 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 650 | 96.6% | 395.0 | 0.00e+00 | 86.9% |
| 251 | MG374461 | Pteromalidae sp. BIOUG25608-D11 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 652 | 96.9% | 394.0 | 0.00e+00 | 86.9% |
| 252 | KF573374 | Trichogramma pretiosum isolate 1A cytochrome c oxidase subunit I (COI) gene, partial cds; mitochondrial | 652 | 96.9% | 394.0 | 0.00e+00 | 86.9% |
| 253 | MN672858 | Pteromalidae sp. BOLD:ADS2745 voucher CHARS00034-H02 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 649 | 96.4% | 394.0 | 0.00e+00 | 86.9% |
| 254 | OK205262 | Trichogramma australicum voucher HB_NUU_16_1_1 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 652 | 96.9% | 394.0 | 0.00e+00 | 86.9% |
| 255 | KR878665 | Pteromalidae sp. BOLD-2016 voucher BIOUG08665-A03 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 652 | 96.9% | 394.0 | 0.00e+00 | 86.9% |
| 256 | MN682850 | Pachyneuron groenlandicum voucher CHARS00261-H09 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 648 | 96.3% | 393.0 | 0.00e+00 | 86.9% |
| 257 | MN675001 | Pteromalidae sp. BOLD:ADS2745 voucher CHARS00046-A10 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 648 | 96.3% | 393.0 | 0.00e+00 | 86.9% |
| 258 | MN677748 | Pteromalidae sp. BOLD:ADS2745 voucher CHARS00034-G07 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 648 | 96.3% | 393.0 | 0.00e+00 | 86.9% |
| 259 | OP443476 | Trichogramma sp. voucher YT-089 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 96.7% | 393.0 | 0.00e+00 | 86.9% |
| 260 | MN673697 | Pachyneuron groenlandicum voucher CHARS00170-C02 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 648 | 96.3% | 393.0 | 0.00e+00 | 86.9% |
| 261 | MH456773 | Encyrtidae sp. 24053 cytochrome c oxidase subunit I (COI) gene, partial cds; mitochondrial | 651 | 96.7% | 393.0 | 0.00e+00 | 86.9% |
| 262 | MN673326 | Pteromalidae sp. BOLD:ADS2745 voucher CHARS00039-A01 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 648 | 96.3% | 393.0 | 0.00e+00 | 86.9% |
| 263 | MN678167 | Tetrastichinae sp. BOLD:ACB0156 voucher CHARS00281-B08 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 648 | 96.3% | 393.0 | 0.00e+00 | 86.9% |
| 264 | MN679507 | Pachyneuron groenlandicum voucher CHARS00193-A03 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 648 | 96.3% | 393.0 | 0.00e+00 | 86.9% |
| 265 | OP443532 | Trichogramma sp. voucher YT-012 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 96.7% | 393.0 | 0.00e+00 | 86.9% |
| 266 | KR874027 | Eulophidae sp. BOLD-2016 voucher BIOUG06857-H03 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 647 | 96.1% | 392.0 | 0.00e+00 | 86.9% |
| 267 | MN676714 | Pteromalidae sp. BOLD:ADS2745 voucher CHARS00039-B05 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 647 | 96.1% | 392.0 | 0.00e+00 | 86.9% |
| 268 | MN681150 | Pachyneuron groenlandicum voucher CHARS00206-A11 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 647 | 96.1% | 392.0 | 0.00e+00 | 86.9% |
| 269 | MN670668 | Pachyneuron groenlandicum voucher CHARS00141-G12 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 647 | 96.1% | 392.0 | 0.00e+00 | 86.9% |
| 270 | MN678679 | Tetrastichinae sp. BOLD:ACB0156 voucher CHARS00276-C10 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 647 | 96.1% | 392.0 | 0.00e+00 | 86.9% |
| 271 | MN676216 | Pteromalidae sp. BOLD:ADS2745 voucher CHARS00040-H05 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 647 | 96.1% | 392.0 | 0.00e+00 | 86.9% |
| 272 | MN671988 | Pteromalidae sp. BOLD:ADS2745 voucher CHARS00059-B11 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 646 | 96.0% | 391.0 | 0.00e+00 | 86.9% |
| 273 | OL538101 | Toxeuma discretum voucher SMNS_38372 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 645 | 95.8% | 390.0 | 0.00e+00 | 86.9% |
| 274 | OL538116 | Toxeuma discretum voucher SMNS_38364 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 645 | 95.8% | 390.0 | 0.00e+00 | 86.9% |
| 275 | OQ789199 | Aphelinus varipes voucher Langfang cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 673 | 100.0% | 406.0 | 0.00e+00 | 86.8% |
| 276 | NC_069039 | Trichogramma pretiosum mitochondrion, complete genome | 673 | 100.0% | 406.0 | 0.00e+00 | 86.8% |
| 277 | NC_028196 | Megaphragma amalphitanum mitochondrion, complete genome | 673 | 100.0% | 406.0 | 0.00e+00 | 86.8% |
| 278 | PV031783 | Eurytoma discordans voucher USNMENT01938342 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 673 | 100.0% | 406.0 | 0.00e+00 | 86.8% |
| 279 | OP498124 | Philotrypesis sp. 2 AYW-2022a voucher Ph2_glabe_6 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 667 | 99.1% | 403.0 | 0.00e+00 | 86.8% |
| 280 | OP498117 | Philotrypesis sp. 1 AYW-2022a voucher Ph1_pisoc_6 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 667 | 99.1% | 403.0 | 0.00e+00 | 86.8% |
| 281 | OP498120 | Philotrypesis sp. 2 AYW-2022a voucher Ph2_glabe_1 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 667 | 99.1% | 403.0 | 0.00e+00 | 86.8% |
| 282 | OP498188 | Sycoscapter sp. voucher Sy_glabe_6 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 667 | 99.1% | 403.0 | 0.00e+00 | 86.8% |
| 283 | OP498239 | Sycoscapter sp. 3 AYW-2022a voucher Sy3_altis_1 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 667 | 99.1% | 403.0 | 0.00e+00 | 86.8% |
| 284 | OP498187 | Sycoscapter sp. voucher Sy_glabe_5 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 667 | 99.1% | 403.0 | 0.00e+00 | 86.8% |
| 285 | OP498229 | Sycoscapter sp. 2 AYW-2022a voucher Sy2_ortho_1 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 667 | 99.1% | 403.0 | 0.00e+00 | 86.8% |
| 286 | OP498230 | Sycoscapter sp. 2 AYW-2022a voucher Sy2_pisoc_2 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 667 | 99.1% | 403.0 | 0.00e+00 | 86.8% |
| 287 | OP498121 | Philotrypesis sp. 2 AYW-2022a voucher Ph2_glabe_2 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 667 | 99.1% | 403.0 | 0.00e+00 | 86.8% |
| 288 | OP498209 | Sycoscapter sp. 1 AYW-2022a voucher Sy1_ortho_1 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 667 | 99.1% | 403.0 | 0.00e+00 | 86.8% |
| 289 | OP498183 | Sycoscapter sp. voucher Sy_glabe_1_2 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 667 | 99.1% | 403.0 | 0.00e+00 | 86.8% |
| 290 | MK530786 | Lipothymus sp. Lip_curti_1 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 667 | 99.1% | 403.0 | 0.00e+00 | 86.8% |
| 291 | OP498125 | Philotrypesis sp. 2 AYW-2022a voucher Ph2_glabe_7 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 667 | 99.1% | 403.0 | 0.00e+00 | 86.8% |
| 292 | LC260605 | Aphelinus varipes mitochondrial COX1 gene for cytochrome c oxidase subunit 1, partial cds, isolate: Av000039 | 656 | 97.5% | 395.0 | 0.00e+00 | 86.8% |
| 293 | MG337854 | Baryscapus sp. BIOUG24652-D10 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 652 | 96.9% | 394.0 | 0.00e+00 | 86.8% |
| 294 | MG505322 | Cecidostiba sp. BIOUG20472-G02 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 652 | 96.9% | 394.0 | 0.00e+00 | 86.8% |
| 295 | LC604139 | Pteromalidae sp. 1 YY-2021 TUS60503-3 mitochondrial COI gene for cytochrome c oxidase subunit 1, partial sequence, clone: F102LHCOLCO | 651 | 96.7% | 393.0 | 0.00e+00 | 86.8% |
| 296 | KR901342 | Pteromalinae sp. BOLD-2016 voucher BIOUG02857-B05 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 96.7% | 393.0 | 0.00e+00 | 86.8% |
| 297 | KR797526 | Aphelinus sp. BOLD-2016 voucher BIOUG06823-A09 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 96.7% | 393.0 | 0.00e+00 | 86.8% |
| 298 | KJ018452 | Eupelmus confusus isolate 10596 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 651 | 96.7% | 393.0 | 0.00e+00 | 86.8% |
| 299 | MG505937 | Pteromalidae sp. BIOUG26717-H10 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 96.7% | 393.0 | 0.00e+00 | 86.8% |
| 300 | KM563206 | Pteromalidae sp. BOLD:ACD2036 voucher BIOUG04281-B02 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 96.7% | 393.0 | 0.00e+00 | 86.8% |
| 301 | MG334748 | Eulophidae sp. BIOUG23196-D10 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 96.7% | 393.0 | 0.00e+00 | 86.8% |
| 302 | JN301089 | Hymenoptera sp. BOLD:AAA8291 voucher BIOUG| 651 |
96.7% |
393.0 |
0.00e+00 |
86.8% |
|
| 303 | KR797819 | Homoporus pyrsius voucher BIOUG01049-H09 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 96.7% | 393.0 | 0.00e+00 | 86.8% |
| 304 | HQ106774 | Baryscapus sp. MAS-2010 voucher EE-12824-86 P2 cytochrome oxidase subunit 1-like (COI) gene, partial sequence; mitochondrial | 651 | 96.7% | 393.0 | 0.00e+00 | 86.8% |
| 305 | LC201495 | Hymenoptera sp. P2 mitochondrial COX1 gene for cytochrome c oxidase subunit 1, partial cds | 650 | 96.6% | 392.0 | 0.00e+00 | 86.8% |
| 306 | MN675946 | Pteromalidae sp. BOLD:ADS2745 voucher CHARS00046-A07 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 649 | 96.4% | 391.0 | 0.00e+00 | 86.8% |
| 307 | MN675511 | Pteromalidae sp. BOLD:ADS2745 voucher CHARS00059-C02 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 649 | 96.4% | 391.0 | 0.00e+00 | 86.8% |
| 308 | MN677700 | Pteromalidae sp. BOLD:ADS2745 voucher CHARS00046-C06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 649 | 96.4% | 391.0 | 0.00e+00 | 86.8% |
| 309 | MG374766 | Pteromalidae sp. BIOUG25489-D04 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 645 | 95.8% | 391.0 | 0.00e+00 | 86.8% |
| 310 | MN682251 | Pachyneuron groenlandicum voucher CHARS00274-F03 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 645 | 95.8% | 390.0 | 0.00e+00 | 86.8% |
| 311 | MN680972 | Pachyneuron groenlandicum voucher CHARS00281-C07 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 644 | 95.7% | 389.0 | 0.00e+00 | 86.8% |
| 312 | KT253009 | Tamarixia radiata isolate 1AGL 9Feb2015-1C cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 668 | 99.3% | 401.0 | 0.00e+00 | 86.7% |
| 313 | OP498196 | Sycoscapter sp. 1 AYW-2022a voucher Sy1_macle_1 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 667 | 99.1% | 400.0 | 0.00e+00 | 86.7% |
| 314 | OP498232 | Sycoscapter sp. 2 AYW-2022a voucher Sy2_pisoc_4 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 667 | 99.1% | 400.0 | 0.00e+00 | 86.7% |
| 315 | OP498210 | Sycoscapter sp. 1 AYW-2022a voucher Sy1_ortho_2 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 667 | 99.1% | 400.0 | 0.00e+00 | 86.7% |
| 316 | OP498186 | Sycoscapter sp. voucher Sy_glabe_4 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 667 | 99.1% | 400.0 | 0.00e+00 | 86.7% |
| 317 | OP498212 | Sycoscapter sp. 1 AYW-2022a voucher Sy1_pisoc_2 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 667 | 99.1% | 400.0 | 0.00e+00 | 86.7% |
| 318 | OP498116 | Philotrypesis sp. 1 AYW-2022a voucher Ph1_pisoc_5 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 667 | 99.1% | 400.0 | 0.00e+00 | 86.7% |
| 319 | OP498201 | Sycoscapter sp. 1 AYW-2022a voucher Sy1_macle_6 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 667 | 99.1% | 400.0 | 0.00e+00 | 86.7% |
| 320 | OP498203 | Sycoscapter sp. 1 AYW-2022a voucher Sy1_micro_2 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 667 | 99.1% | 400.0 | 0.00e+00 | 86.7% |
| 321 | OP498114 | Philotrypesis sp. 1 AYW-2022a voucher Ph1_pisoc_3 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 667 | 99.1% | 400.0 | 0.00e+00 | 86.7% |
| 322 | OP498211 | Sycoscapter sp. 1 AYW-2022a voucher Sy1_pisoc_1 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 667 | 99.1% | 400.0 | 0.00e+00 | 86.7% |
| 323 | OP498075 | Apocrypta bakeri voucher Apba_hisp_3 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 667 | 99.1% | 400.0 | 0.00e+00 | 86.7% |
| 324 | KM557513 | Pteromalidae sp. BOLD:AAU9134 voucher BIOUG03257-C05 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 652 | 96.9% | 395.0 | 0.00e+00 | 86.7% |
| 325 | MG380467 | Pteromalidae sp. BIOUG25748-D04 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 96.7% | 393.0 | 0.00e+00 | 86.7% |
| 326 | MF956304 | Torymus sp. PJAN1046 cytochrome oxidase subunit I gene, partial cds; mitochondrial | 651 | 96.7% | 392.0 | 0.00e+00 | 86.7% |
| 327 | KR887110 | Torymidae sp. BOLD-2016 voucher BIOUG08658-H03 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 96.7% | 392.0 | 0.00e+00 | 86.7% |
| 328 | MG343086 | Tetrastichinae sp. BIOUG24652-C10 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 652 | 96.9% | 392.0 | 0.00e+00 | 86.7% |
| 329 | MG340728 | Entedoninae sp. BIOUG22829-F01 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 652 | 96.9% | 391.0 | 0.00e+00 | 86.7% |
| 330 | MF900016 | Baryscapus sp. BIOUG21674-F12 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 652 | 96.9% | 391.0 | 0.00e+00 | 86.7% |
| 331 | KF573406 | Trichogramma pretiosum isolate A24 cytochrome c oxidase subunit I (COI) gene, partial cds; mitochondrial | 652 | 96.9% | 391.0 | 0.00e+00 | 86.7% |
| 332 | KJ444525 | Trichogramma sp. BOLD:ACE5676 voucher BIOUG03904-C09 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 652 | 96.9% | 391.0 | 0.00e+00 | 86.7% |
| 333 | OP443509 | Trichogramma sp. voucher YT-191 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 652 | 96.9% | 391.0 | 0.00e+00 | 86.7% |
| 334 | KF573393 | Trichogramma pretiosum isolate A11 cytochrome c oxidase subunit I (COI) gene, partial cds; mitochondrial | 652 | 96.9% | 391.0 | 0.00e+00 | 86.7% |
| 335 | KR348771 | Eupelmus atropurpureus isolate 10580 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 652 | 96.9% | 391.0 | 0.00e+00 | 86.7% |
| 336 | KF573382 | Trichogramma pretiosum isolate 9A cytochrome c oxidase subunit I (COI) gene, partial cds; mitochondrial | 652 | 96.9% | 391.0 | 0.00e+00 | 86.7% |
| 337 | HQ599571 | Aphelinus varipes cytochrome c oxidase subunit I (COI) gene, partial cds; mitochondrial | 652 | 96.9% | 391.0 | 0.00e+00 | 86.7% |
| 338 | KJ209465 | Trichogrammatidae sp. BOLD:ACC8400 voucher BIOUG03904-D04 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 96.7% | 391.0 | 0.00e+00 | 86.7% |
| 339 | MZ632618 | Achrysocharoides sp. ZMUO 026955 voucher ZMUO.026955 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 96.7% | 390.0 | 0.00e+00 | 86.7% |
| 340 | MN672436 | Pteromalidae sp. BOLD:ADS2745 voucher CHARS00039-B12 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 648 | 96.3% | 390.0 | 0.00e+00 | 86.7% |
| 341 | MN667690 | Pteromalidae sp. BOLD:ADS2745 voucher CHARS00033-B04 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 648 | 96.3% | 390.0 | 0.00e+00 | 86.7% |
| 342 | KR807374 | Pteromalidae sp. BOLD-2016 voucher BIOUG07198-G11 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 96.7% | 390.0 | 0.00e+00 | 86.7% |
| 343 | MG378861 | Pteromalidae sp. BIOUG25571-F10 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 96.7% | 390.0 | 0.00e+00 | 86.7% |
| 344 | MF929198 | Aphelinidae sp. BIOUG27501-E02 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 96.7% | 390.0 | 0.00e+00 | 86.7% |
| 345 | JN300309 | Hymenoptera sp. BOLD:AAU9867 voucher BIOUG| 651 |
96.7% |
390.0 |
0.00e+00 |
86.7% |
|
| 346 | MN670958 | Pteromalidae sp. BOLD:ADS2745 voucher CHARS00046-D01 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 648 | 96.3% | 390.0 | 0.00e+00 | 86.7% |
| 347 | MH927754 | Eulophidae sp. INDOBIOSYS-CCDB26103-C04 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 96.7% | 390.0 | 0.00e+00 | 86.7% |
| 348 | MN675653 | Pteromalidae sp. BOLD:ADS2745 voucher CHARS00074-B01 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 648 | 96.3% | 390.0 | 0.00e+00 | 86.7% |
| 349 | KU052674 | Anastatus bangalorensis voucher CUAB-01-A1 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 651 | 96.7% | 390.0 | 0.00e+00 | 86.7% |
| 350 | KJ163151 | Hymenoptera sp. BOLD:ACC7672 voucher BIOUG03517-C08 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 96.7% | 390.0 | 0.00e+00 | 86.7% |
| 351 | KR789217 | Aphelinus sp. BOLD-2016 voucher BIOUG01599-E02 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 96.7% | 390.0 | 0.00e+00 | 86.7% |
| 352 | KM562531 | Hymenoptera sp. BOLD:ACD0943 voucher BIOUG04164-A07 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 96.7% | 390.0 | 0.00e+00 | 86.7% |
| 353 | KM561185 | Pteromalidae sp. BOLD:ABW3164 voucher BIOUG03697-D09 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 96.7% | 390.0 | 0.00e+00 | 86.7% |
| 354 | KR787348 | Eulophidae sp. BOLD-2016 voucher BIOUG01029-B05 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 96.7% | 390.0 | 0.00e+00 | 86.7% |
| 355 | MF956358 | Pseudotorymus sp. PJAN1154 cytochrome oxidase subunit I gene, partial cds; mitochondrial | 651 | 96.7% | 390.0 | 0.00e+00 | 86.7% |
| 356 | ON557483 | Megaphragma viggianii voucher ITM1 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 651 | 96.7% | 390.0 | 0.00e+00 | 86.7% |
| 357 | KR877783 | Eulophidae sp. BOLD-2016 voucher BIOUG06519-F01 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 96.7% | 390.0 | 0.00e+00 | 86.7% |
| 358 | MN674197 | Pteromalidae sp. BOLD:ADS2745 voucher CHARS00035-A05 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 648 | 96.3% | 390.0 | 0.00e+00 | 86.7% |
| 359 | MN670001 | Pteromalidae sp. BOLD:ADS2745 voucher CHARS00046-B02 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 647 | 96.1% | 389.0 | 0.00e+00 | 86.7% |
| 360 | MN674756 | Pteromalidae sp. BOLD:ADS2745 voucher CHARS00040-H08 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 647 | 96.1% | 389.0 | 0.00e+00 | 86.7% |
| 361 | MG445423 | Aphelinus sp. BIOUG27406-H11 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 647 | 96.1% | 389.0 | 0.00e+00 | 86.7% |
| 362 | XM_023457693 | PREDICTED: Trichogramma pretiosum cytochrome c oxidase subunit 1-like (LOC111693306), partial mRNA | 650 | 96.6% | 389.0 | 0.00e+00 | 86.7% |
| 363 | MN666906 | Pteromalidae sp. BOLD:ADS2745 voucher CHARS00063-C01 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 647 | 96.1% | 389.0 | 0.00e+00 | 86.7% |
| 364 | MN673068 | Pteromalidae sp. BOLD:ADS2745 voucher CHARS00046-A12 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 647 | 96.1% | 389.0 | 0.00e+00 | 86.7% |
| 365 | MN666508 | Pteromalidae sp. BOLD:ADS2745 voucher CHARS00066-A03 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 646 | 96.0% | 388.0 | 0.00e+00 | 86.7% |
| 366 | MN679753 | Pteromalidae sp. BOLD:ADS2745 voucher CHARS00059-B09 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 646 | 96.0% | 388.0 | 0.00e+00 | 86.7% |
| 367 | MN674732 | Pteromalidae sp. BOLD:ADS2745 voucher CHARS00039-B08 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 646 | 96.0% | 388.0 | 0.00e+00 | 86.7% |
| 368 | KJ911022 | Trichogramma pretiosum cytochrome oxidase subunit 1 gene, partial cds; mitochondrial | 649 | 96.4% | 388.0 | 0.00e+00 | 86.7% |
| 369 | MN678672 | Pteromalidae sp. BOLD:ADS2745 voucher CHARS00046-B10 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 646 | 96.0% | 388.0 | 0.00e+00 | 86.7% |
| 370 | MG445570 | Aphelinus sp. BIOUG25534-H09 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 646 | 96.0% | 388.0 | 0.00e+00 | 86.7% |
| 371 | MN667744 | Pteromalidae sp. BOLD:ADS2745 voucher CHARS00192-F08 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 645 | 95.8% | 387.0 | 0.00e+00 | 86.7% |
| 372 | PQ375440 | Aphelinus maidis cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 673 | 100.0% | 403.0 | 0.00e+00 | 86.6% |
| 373 | OL628982 | Apocrypta varicolor voucher Af1-2 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 673 | 100.0% | 403.0 | 0.00e+00 | 86.6% |
| 374 | MN123622 | Tamarixia radiata mitochondrion, partial genome | 673 | 100.0% | 403.0 | 0.00e+00 | 86.6% |
| 375 | OR592589 | Pteromalus intermedius voucher FRI/NFIC/23531 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 673 | 100.0% | 403.0 | 0.00e+00 | 86.6% |
| 376 | OP498206 | Sycoscapter sp. 1 AYW-2022a voucher Sy1_micro_5 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 667 | 99.1% | 397.0 | 0.00e+00 | 86.6% |
| 377 | OP498198 | Sycoscapter sp. 1 AYW-2022a voucher Sy1_macle_3 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 667 | 99.1% | 397.0 | 0.00e+00 | 86.6% |
| 378 | OP498208 | Sycoscapter sp. 1 AYW-2022a voucher Sy1_micro_7 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 667 | 99.1% | 397.0 | 0.00e+00 | 86.6% |
| 379 | MK530769 | Walkerella benjamini voucher Wabe_benja_3 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 667 | 99.1% | 397.0 | 0.00e+00 | 86.6% |
| 380 | KR888305 | Pteromalidae sp. BOLD-2016 voucher BIOUG06250-H06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 96.7% | 390.0 | 0.00e+00 | 86.6% |
| 381 | HQ106776 | Baryscapus sp. MAS-2010 voucher EE-12813ii-86 P2 cytochrome oxidase subunit 1-like (COI) gene, partial sequence; mitochondrial | 651 | 96.7% | 390.0 | 0.00e+00 | 86.6% |
| 382 | MG383334 | Pteromalidae sp. BIOUG24271-C06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 96.7% | 390.0 | 0.00e+00 | 86.6% |
| 383 | OP292575 | Achrysocharoides cilla voucher NK881 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 650 | 96.6% | 389.0 | 0.00e+00 | 86.6% |
| 384 | OP292631 | Achrysocharoides cilla voucher NK884 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 650 | 96.6% | 389.0 | 0.00e+00 | 86.6% |
| 385 | OP292585 | Achrysocharoides cilla voucher NK894 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 650 | 96.6% | 389.0 | 0.00e+00 | 86.6% |
| 386 | KT252998 | Trichogramma pretiosum isolate Coahuila_Torreon_26-nov-2014_ A.Guzman-Larralde_JoseReyesHernandez(lab)1J cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 652 | 96.9% | 388.0 | 0.00e+00 | 86.6% |
| 387 | KF573373 | Trichogramma pretiosum isolate UCR-23O cytochrome c oxidase subunit I (COI) gene, partial cds; mitochondrial | 652 | 96.9% | 388.0 | 0.00e+00 | 86.6% |
| 388 | OP443472 | Trichogramma sp. voucher YT-243 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 652 | 96.9% | 388.0 | 0.00e+00 | 86.6% |
| 389 | MN676755 | Pteromalidae sp. BOLD:ADS1250 voucher CHARS00206-C01 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 649 | 96.4% | 388.0 | 0.00e+00 | 86.6% |
| 390 | KT252999 | Trichogramma pretiosum isolate Culiacan_Sinaloa_CRIBIO_6-nov-2014Adriana-Guzman-Larralde_JoseReyesHernandez(lab)7J cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 652 | 96.9% | 388.0 | 0.00e+00 | 86.6% |
| 391 | KF573380 | Trichogramma pretiosum isolate 7A cytochrome c oxidase subunit I (COI) gene, partial cds; mitochondrial | 652 | 96.9% | 388.0 | 0.00e+00 | 86.6% |
| 392 | OP443549 | Trichogramma sp. voucher YT-105 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 652 | 96.9% | 388.0 | 0.00e+00 | 86.6% |
| 393 | KF573379 | Trichogramma pretiosum isolate 6A cytochrome c oxidase subunit I (COI) gene, partial cds; mitochondrial | 652 | 96.9% | 388.0 | 0.00e+00 | 86.6% |
| 394 | KF573378 | Trichogramma pretiosum isolate 5A cytochrome c oxidase subunit I (COI) gene, partial cds; mitochondrial | 652 | 96.9% | 388.0 | 0.00e+00 | 86.6% |
| 395 | MN679259 | Pteromalidae sp. BOLD:ADS2745 voucher CHARS00033-C02 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 649 | 96.4% | 388.0 | 0.00e+00 | 86.6% |
| 396 | KM564617 | Pteromalidae sp. BOLD:ACE0765 voucher BIOUG04374-G09 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 96.7% | 387.0 | 0.00e+00 | 86.6% |
| 397 | FJ209089 | Apocrypta bakeri cytochrome c oxidase subunit I gene, partial cds; mitochondrial | 673 | 100.0% | 400.0 | 0.00e+00 | 86.5% |
| 398 | OL628981 | Apocrypta varicolor voucher Af1-1 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 673 | 100.0% | 400.0 | 0.00e+00 | 86.5% |
| 399 | JQ083716 | Encarsia perniciosi isolate Epe_36 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 673 | 100.0% | 400.0 | 0.00e+00 | 86.5% |
| 400 | MZ348611 | Ophelimus eucalypti voucher HC740 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 673 | 100.0% | 400.0 | 0.00e+00 | 86.5% |
| 401 | KU836507 | Trichogramma dendrolimi mitochondrion, complete genome | 673 | 100.0% | 400.0 | 0.00e+00 | 86.5% |
| 402 | JQ083717 | Encarsia perniciosi isolate Epe_37 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 673 | 100.0% | 400.0 | 0.00e+00 | 86.5% |
| 403 | JQ083712 | Encarsia perniciosi isolate Epe_32 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 673 | 100.0% | 400.0 | 0.00e+00 | 86.5% |
| 404 | ON637051 | Tetrastichinae sp. voucher RCP B cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 673 | 100.0% | 400.0 | 0.00e+00 | 86.5% |
| 405 | JQ083714 | Encarsia perniciosi isolate Epe_34 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 673 | 100.0% | 400.0 | 0.00e+00 | 86.5% |
| 406 | JQ083713 | Encarsia perniciosi isolate Epe_33 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 673 | 100.0% | 400.0 | 0.00e+00 | 86.5% |
| 407 | JQ083711 | Encarsia perniciosi isolate Epe_31 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 673 | 100.0% | 400.0 | 0.00e+00 | 86.5% |
| 408 | MT906648 | Apocrypta bakeri mitochondrion, partial genome | 673 | 100.0% | 400.0 | 0.00e+00 | 86.5% |
| 409 | PQ667799 | Trichogramma kaykai strain KSX58 mitochondrion, complete genome | 673 | 100.0% | 400.0 | 0.00e+00 | 86.5% |
| 410 | MZ348610 | Ophelimus eucalypti voucher HC739 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 671 | 99.7% | 398.0 | 0.00e+00 | 86.5% |
| 411 | MZ605328 | Ophelimus eucalypti voucher HC787 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 671 | 99.7% | 398.0 | 0.00e+00 | 86.5% |
| 412 | OP498185 | Sycoscapter sp. voucher Sy_glabe_3 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 667 | 99.1% | 397.0 | 0.00e+00 | 86.5% |
| 413 | OP498076 | Apocrypta bakeri voucher Apba_hisp_5 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 667 | 99.1% | 397.0 | 0.00e+00 | 86.5% |
| 414 | OP498074 | Apocrypta bakeri voucher Apba_hisp_1 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 667 | 99.1% | 397.0 | 0.00e+00 | 86.5% |
| 415 | OP498122 | Philotrypesis sp. 2 AYW-2022a voucher Ph2_glabe_3 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 667 | 99.1% | 397.0 | 0.00e+00 | 86.5% |
| 416 | KR800918 | Aphelinus sp. BOLD-2016 voucher BIOUG01605-H10 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 96.7% | 389.0 | 0.00e+00 | 86.5% |
| 417 | MG374096 | Pteromalidae sp. BIOUG24493-D04 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 96.7% | 389.0 | 0.00e+00 | 86.5% |
| 418 | HQ106727 | Baryscapus coerulescens voucher EE-174-88 P3 cytochrome oxidase subunit 1-like (COI) gene, partial sequence; mitochondrial | 651 | 96.7% | 389.0 | 0.00e+00 | 86.5% |
| 419 | KY844182 | Pteromalidae sp. BIOUG02399-H03 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 96.7% | 389.0 | 0.00e+00 | 86.5% |
| 420 | KR889499 | Pteromalidae sp. BOLD-2016 voucher BIOUG05551-E11 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 652 | 96.9% | 388.0 | 0.00e+00 | 86.5% |
| 421 | HQ106738 | Baryscapus coerulescens voucher EE-1314-89 P3 cytochrome oxidase subunit 1-like (COI) gene, partial sequence; mitochondrial | 651 | 96.7% | 388.0 | 0.00e+00 | 86.5% |
| 422 | KY836459 | Tetrastichinae sp. BIOUG02443-G06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 652 | 96.9% | 388.0 | 0.00e+00 | 86.5% |
| 423 | KJ208837 | Eulophidae sp. BOLD:ACC7618 voucher BIOUG03904-D09 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 96.7% | 388.0 | 0.00e+00 | 86.5% |
| 424 | OQ921618 | Trichogramma chilonis voucher Tc-3 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 652 | 96.9% | 388.0 | 0.00e+00 | 86.5% |
| 425 | MT219447 | Trichogramma chilonis voucher IMDx0549 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 652 | 96.9% | 388.0 | 0.00e+00 | 86.5% |
| 426 | HQ106744 | Baryscapus coerulescens voucher EE-67-93 MP cytochrome oxidase subunit 1-like (COI) gene, partial sequence; mitochondrial | 651 | 96.7% | 388.0 | 0.00e+00 | 86.5% |
| 427 | OQ921619 | Trichogramma chilonis voucher Tc-4 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 652 | 96.9% | 388.0 | 0.00e+00 | 86.5% |
| 428 | OQ921617 | Trichogramma chilonis voucher Tc-2 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 652 | 96.9% | 388.0 | 0.00e+00 | 86.5% |
| 429 | HQ106755 | Baryscapus coerulescens voucher EE-193-88 MP cytochrome oxidase subunit 1-like (COI) gene, partial sequence; mitochondrial | 651 | 96.7% | 388.0 | 0.00e+00 | 86.5% |
| 430 | KJ444952 | Trichogramma sp. BOLD:ACE5676 voucher BIOUG03904-B08 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 652 | 96.9% | 388.0 | 0.00e+00 | 86.5% |
| 431 | HQ106686 | Baryscapus coerulescens voucher EE-7057-88 P3 cytochrome oxidase subunit 1-like (COI) gene, partial sequence; mitochondrial | 651 | 96.7% | 388.0 | 0.00e+00 | 86.5% |
| 432 | OQ921620 | Trichogramma chilonis voucher Tc-5 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 652 | 96.9% | 388.0 | 0.00e+00 | 86.5% |
| 433 | KM556852 | Pteromalidae sp. BOLD:ACD0516 voucher BIOUG04047-D03 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 96.7% | 387.0 | 0.00e+00 | 86.5% |
| 434 | OQ689719 | Trichogramma pretiosum isolate MJU cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 651 | 96.7% | 387.0 | 0.00e+00 | 86.5% |
| 435 | KR798650 | Achrysocharoides sp. BOLD-2016 voucher BIOUG07464-D05 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 96.7% | 387.0 | 0.00e+00 | 86.5% |
| 436 | MG923513 | Pteromalus puparum mitochondrion, partial genome | 673 | 100.0% | 397.0 | 0.00e+00 | 86.4% |
| 437 | PV031750 | Bruchophagus asphodelinae voucher USNMENT01525844 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 670 | 99.6% | 397.0 | 0.00e+00 | 86.4% |
| 438 | NC_039656 | Pteromalus puparum mitochondrion, complete genome | 673 | 100.0% | 397.0 | 0.00e+00 | 86.4% |
| 439 | MZ605326 | Ophelimus eucalypti voucher HC784 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 668 | 99.3% | 395.0 | 0.00e+00 | 86.4% |
| 440 | NC_069040 | Trichogramma cacaeciae mitochondrion, complete genome | 671 | 99.7% | 395.0 | 0.00e+00 | 86.4% |
| 441 | OP498197 | Sycoscapter sp. 1 AYW-2022a voucher Sy1_macle_2 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 667 | 99.1% | 394.0 | 0.00e+00 | 86.4% |
| 442 | OP498231 | Sycoscapter sp. 2 AYW-2022a voucher Sy2_pisoc_3 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 667 | 99.1% | 394.0 | 0.00e+00 | 86.4% |
| 443 | OP498136 | Philotrypesis sp. 2 AYW-2022a voucher Ph2_macle_5 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 667 | 99.1% | 394.0 | 0.00e+00 | 86.4% |
| 444 | OP498227 | Sycoscapter sp. 2 AYW-2022a voucher Sy2_macle_6 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 667 | 99.1% | 394.0 | 0.00e+00 | 86.4% |
| 445 | OP498223 | Sycoscapter sp. 2 AYW-2022a voucher Sy2_macle_2 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 667 | 99.1% | 394.0 | 0.00e+00 | 86.4% |
| 446 | OP498221 | Sycoscapter sp. 2 AYW-2022a voucher Sy2_altis_4 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 667 | 99.1% | 394.0 | 0.00e+00 | 86.4% |
| 447 | OP498138 | Philotrypesis sp. 2 AYW-2022a voucher Ph2_pisoc_1 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 667 | 99.1% | 394.0 | 0.00e+00 | 86.4% |
| 448 | OP498242 | Sycoscapter roxburghi voucher Syro_auri_2 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 667 | 99.1% | 394.0 | 0.00e+00 | 86.4% |
| 449 | OP498254 | Sycoscapter trifemmensis voucher Sytri_semi_3 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 667 | 99.1% | 394.0 | 0.00e+00 | 86.4% |
| 450 | MZ605335 | Ophelimus eucalypti voucher HC794 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 659 | 97.9% | 389.0 | 0.00e+00 | 86.4% |
| 451 | MZ558501 | Tamarixia radiata isolate Guangzhou-IZ-1 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 655 | 97.3% | 388.0 | 0.00e+00 | 86.4% |
| 452 | OP498104 | Philotrypesis sp. 1 AYW-2022a voucher Ph1_glabe_2 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 667 | 99.1% | 391.0 | 0.00e+00 | 86.3% |
| 453 | MZ605330 | Ophelimus eucalypti voucher HC789 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 662 | 98.4% | 389.0 | 0.00e+00 | 86.3% |
| 454 | JQ268913 | Aphytis hispanicus isolate UG-Z14 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 673 | 100.0% | 394.0 | 0.00e+00 | 86.2% |
| 455 | PQ375437 | Aphelinus humilis cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 673 | 100.0% | 394.0 | 0.00e+00 | 86.2% |
| 456 | OL628994 | Apocrypta caudata voucher Av1-1 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 673 | 100.0% | 394.0 | 0.00e+00 | 86.2% |
| 457 | MT576110 | Tetrastichinae sp. G0042 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 673 | 100.0% | 394.0 | 0.00e+00 | 86.2% |
| 458 | JQ083709 | Aphytis lingnanensis isolate Ali_69 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 673 | 100.0% | 394.0 | 0.00e+00 | 86.2% |
| 459 | MZ318061 | Stenomesius japonicus voucher SJS 121 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 670 | 99.6% | 392.0 | 0.00e+00 | 86.2% |
| 460 | PQ530505 | Euderus albitarsis voucher SCBG-E0004449 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 668 | 99.3% | 392.0 | 0.00e+00 | 86.2% |
| 461 | OP498190 | Sycoscapter sp. voucher Sy_tinc_2 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 667 | 99.1% | 391.0 | 0.00e+00 | 86.2% |
| 462 | OP498233 | Sycoscapter sp. 2 AYW-2022a voucher Sy2_pisoc_5 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 667 | 99.1% | 391.0 | 0.00e+00 | 86.2% |
| 463 | OP498220 | Sycoscapter sp. 2 AYW-2022a voucher Sy2_altis_2 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 667 | 99.1% | 391.0 | 0.00e+00 | 86.2% |
| 464 | OP498160 | Philotrypesis pilosa voucher Phpi_hisp_2 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 667 | 99.1% | 391.0 | 0.00e+00 | 86.2% |
| 465 | OP498243 | Sycoscapter roxburghi voucher Syro_auri_3 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 667 | 99.1% | 391.0 | 0.00e+00 | 86.2% |
| 466 | OP498194 | Sycoscapter sp. voucher Sy_xiao_1 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 667 | 99.1% | 391.0 | 0.00e+00 | 86.2% |
| 467 | OP498135 | Philotrypesis sp. 2 AYW-2022a voucher Ph2_macle_4 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 667 | 99.1% | 391.0 | 0.00e+00 | 86.2% |
| 468 | OP498248 | Sycoscapter roxburghi voucher Syro_oligo_2 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 667 | 99.1% | 391.0 | 0.00e+00 | 86.2% |
| 469 | OP498246 | Sycoscapter roxburghi voucher Syro_auri_6 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 667 | 99.1% | 391.0 | 0.00e+00 | 86.2% |
| 470 | LC260600 | Aphelinus gossypii mitochondrial COX1 gene for cytochrome c oxidase subunit 1, partial cds, isolate: Ag000034 | 666 | 99.0% | 390.0 | 0.00e+00 | 86.2% |
| 471 | PV055141 | Encarsia sp. voucher ICAR-NBAIR, HYM, Encarsia sp. 8.2 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 666 | 99.0% | 391.0 | 0.00e+00 | 86.1% |
| 472 | NC_058228 | Anisopteromalus calandrae mitochondrion, complete genome | 673 | 100.0% | 391.0 | 0.00e+00 | 86.1% |
| 473 | JQ083706 | Aphytis lingnanensis isolate Ali_65 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 673 | 100.0% | 391.0 | 0.00e+00 | 86.1% |
| 474 | PV031741 | Aximopsis sp. 1 YMZ-2025a voucher USNMENT01322402 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 673 | 100.0% | 391.0 | 0.00e+00 | 86.1% |
| 475 | NC_079567 | Tetrastichus howardi mitochondrion, complete genome | 673 | 100.0% | 391.0 | 0.00e+00 | 86.1% |
| 476 | ON623671 | Pachyneuron aphidis isolate def2 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 672 | 99.9% | 390.0 | 0.00e+00 | 86.1% |
| 477 | OP498253 | Sycoscapter trifemmensis voucher Sytri_semi_2 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 667 | 99.1% | 388.0 | 0.00e+00 | 86.1% |
| 478 | OP498192 | Sycoscapter sp. voucher Sy_tinc_4 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 667 | 99.1% | 388.0 | 0.00e+00 | 86.1% |
| 479 | OP498105 | Philotrypesis sp. 1 AYW-2022a voucher Ph1_glabe_3 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 667 | 99.1% | 388.0 | 0.00e+00 | 86.1% |
| 480 | OP498241 | Sycoscapter roxburghi voucher Syro_auri_1 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 667 | 99.1% | 388.0 | 0.00e+00 | 86.1% |
| 481 | OP498222 | Sycoscapter sp. 2 AYW-2022a voucher Sy2_macle_1 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 667 | 99.1% | 388.0 | 0.00e+00 | 86.1% |
| 482 | OP498191 | Sycoscapter sp. voucher Sy_tinc_3 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 667 | 99.1% | 388.0 | 0.00e+00 | 86.1% |
| 483 | OP498103 | Philotrypesis sp. 1 AYW-2022a voucher Ph1_glabe_1 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 667 | 99.1% | 388.0 | 0.00e+00 | 86.1% |
| 484 | OP498134 | Philotrypesis sp. 2 AYW-2022a voucher Ph2_macle_3 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 667 | 99.1% | 388.0 | 0.00e+00 | 86.1% |
| 485 | OP498163 | Philotrypesis pilosa voucher Phpi_hisp_5 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 667 | 99.1% | 388.0 | 0.00e+00 | 86.1% |
| 486 | OP498251 | Sycoscapter roxburghi voucher Syro_oligo_5 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 667 | 99.1% | 388.0 | 0.00e+00 | 86.1% |
| 487 | OP498195 | Sycoscapter sp. voucher Sy_xiao_2 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 667 | 99.1% | 388.0 | 0.00e+00 | 86.1% |
| 488 | OP498132 | Philotrypesis sp. 2 AYW-2022a voucher Ph2_macle_1 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 667 | 99.1% | 388.0 | 0.00e+00 | 86.1% |
| 489 | MK530785 | Diaziella yangi voucher Diaya_curti_1 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 667 | 99.1% | 388.0 | 0.00e+00 | 86.1% |
| 490 | OP498219 | Sycoscapter sp. 2 AYW-2022a voucher Sy2_altis_1 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 667 | 99.1% | 388.0 | 0.00e+00 | 86.1% |
| 491 | OP498171 | Sycophila sp. voucher Sp_macle_1 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 667 | 99.1% | 388.0 | 0.00e+00 | 86.1% |
| 492 | OP498247 | Sycoscapter roxburghi voucher Syro_oligo_1 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 667 | 99.1% | 388.0 | 0.00e+00 | 86.1% |
| 493 | NC_039534 | Trichogramma japonicum mitochondrion, complete genome | 673 | 100.0% | 388.0 | 0.00e+00 | 86.0% |
| 494 | MT576113 | Aprostocetus smilax voucher G0046 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 673 | 100.0% | 388.0 | 0.00e+00 | 85.9% |
| 495 | JQ083707 | Aphytis lingnanensis isolate Ali_66 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 673 | 100.0% | 388.0 | 0.00e+00 | 85.9% |
| 496 | PQ375436 | Aphelinus sp. h ZD-2024 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 673 | 100.0% | 388.0 | 0.00e+00 | 85.9% |
| 497 | PQ375441 | Aphelinus sp. t ZD-2024 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 673 | 100.0% | 388.0 | 0.00e+00 | 85.9% |
| 498 | MK577639 | Pachyneuron aphidis mitochondrion, partial genome | 673 | 100.0% | 388.0 | 0.00e+00 | 85.9% |
| 499 | MZ318063 | Stenomesius japonicus voucher SJS 123 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 672 | 99.9% | 388.0 | 0.00e+00 | 85.9% |
| 500 | JQ083705 | Aphytis lingnanensis isolate Ali_64 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 673 | 100.0% | 388.0 | 0.00e+00 | 85.9% |
Selected alignment
Selected taxonomy
| Kingdom | |
|---|---|
| Phylum | |
| Class | |
| Order | |
| Family | |
| Genus | |
| Species |
This sections shows the taxa of interest specified by the submitter. Each of these taxa has been cross-referenced against the candidate species to determine if they might match the taxonomic identity of the sample. A blank row indicates a TOI that did not match any candidate species, meaning that it is unlikely that the sample matches that TOI.
| Taxon of interest | Match rank | Match taxon | Match species | Match accession | Match identity |
|---|---|---|---|---|---|
| Atherigona orientalis | - | - | - | - | - |
See the Database coverage section to see database coverage for taxa of interest.
This analysis evaluates how many independent sources have contributed to reference sequences for each candidate species. This provides a measure of confidence in the taxonomic annotation of references sequences. A sequence that has been annotated by multiple independent sources is more likely to have a correct taxonomic annotation.
Candidates
Independent sources
Flag 4B:
Reference sequence sources lack diversity and may therefore be unreliable
Reasoning: Matching sequence records for this species have only 1-5 independent sources
(found 1 sources)
1 Independent Source
The matching reference sequences for this species have been annotated by 1 independent source(s). A source is considered independent if the author list or publication title is distinct.
Source 1
| Hit accession | Automated | Authors | Title | Journal |
|---|---|---|---|---|
| OQ134363 | False |
Lee,S. Park,D.-Y. |
Direct Submission | Submitted (27-DEC-2022) Insect Biosystematics Laboratory, Seoul National University, Gwanak-ro 1, Seoul 08826, South Korea |
| OQ134362 | False |
Lee,S. Park,D.-Y. |
Direct Submission | Submitted (27-DEC-2022) Insect Biosystematics Laboratory, Seoul National University, Gwanak-ro 1, Seoul 08826, South Korea |
Independent sources
Flag 4B:
Reference sequence sources lack diversity and may therefore be unreliable
Reasoning: Matching sequence records for this species have only 1-5 independent sources
(found 2 sources)
2 Independent Sources
The matching reference sequences for this species have been annotated by 2 independent source(s). A source is considered independent if the author list or publication title is distinct.
Source 1
| Hit accession | Automated | Authors | Title | Journal |
|---|---|---|---|---|
| OQ455486 | False | Cai,P. | Direct Submission | Submitted (18-FEB-2023) Institute of Biological Control, College of Plant Protection, Fujian Agriculture and Forestry University, No. 15 Shangxiadian Road Cangshan District, Fuzhou City, Fujian Province, P.R. China, Fuzhou, Fujian 350002, China |
Source 2
| Hit accession | Automated | Authors | Title | Journal |
|---|---|---|---|---|
| OM956372 | False | Tusun,A. | Direct Submission | Submitted (10-MAR-2022) Plant Protection, Cukurova University, Balcali, Saricam, Adana 01330, Turkey |
The target taxa include candidate species, the preliminary morphology ID, and any taxa of interest provided by the submitter. Each of these taxa are independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of the target taxon. Insufficient coverage of a taxon can result in that taxon not be correctly identified as the taxonomic identity of the sample. For example, if the sample is Homo sapiens, but Homo sapiens sequences are not included in the reference database, the analysis will be unable to identity Homo sapiens as the correct taxonomic identity, and will most likely assign the closest relative with reference data as the taxonomic identity.
Candidates
Preliminary ID
Taxa of interest
Database coverage
Flag 5.1NA:
This taxon could not be fully assessed
Reasoning: Assessment of related species is only possible for taxa at rank genus/species
Flag 5.1NA:
This taxon could not be fully assessed
Reasoning: Assessment of related species is only possible for taxa at rank genus/species
There are NA sequences in the reference database for Pteromalidae sp. at the given locus COI.
Database coverage
Flag 5.2C:
The database has poor support for species in this genus
Reasoning: ≤10% of taxon have reference sequence(s) at the given locus
Flag 5.1B:
The reference data has some support for this taxon
Reasoning: The given locus for this taxon has limited representation in reference database (≤5 entries)
There are 3 sequences in the reference database for Pachycrepoideus vindemmiae at the given locus COI.
Flag 5.2C:
The database has poor support for species in this genus
Reasoning: ≤10% of taxon have reference sequence(s) at the given locus
/ (%) sequence records were found in the reference database for:
Number of GenBank records at locus COI
Flag 5.3C:
Probability that a different related species from the country of origin is the true taxonomic identity: LOW
Reasoning: No species in genus have been observed in the country of origin
/ (%) sequence records were found in the reference database for:
Number of GenBank records at locus COI
Database coverage
Flag 5.1NA:
This taxon could not be fully assessed
Reasoning: Assessment of related species is only possible for taxa at rank genus/species
Flag 5.1NA:
This taxon could not be fully assessed
Reasoning: Assessment of related species is only possible for taxa at rank genus/species
There are NA sequences in the reference database for Muscidae at the given locus COI.
Database coverage
Flag 5.2C:
The database has poor support for species in this genus
Reasoning: ≤10% of taxon have reference sequence(s) at the given locus
Flag 5.1A:
The reference data supports this taxon well
Reasoning: The given locus for this taxon is well represented in reference database (>5 entries)
There are 22 sequences in the reference database for Atherigona orientalis at the given locus COI.
Flag 5.2C:
The database has poor support for species in this genus
Reasoning: ≤10% of taxon have reference sequence(s) at the given locus
/ (%) sequence records were found in the reference database for:
Number of GenBank records at locus COI
Flag 5.3C:
Probability that a different related species from the country of origin is the true taxonomic identity: LOW
Reasoning: No species in genus have been observed in the country of origin
/ (%) sequence records were found in the reference database for:
Number of GenBank records at locus COI
This section provides a phylogeny of the candidate reference sequences. The analyst can use this to make a subjective observation on how well the reference sequences are able to distinguish between species. If the phylogeny shows distinct clades for each species, we can be confident that the molecular data are capable of distinguishing between those species. However, if the phylogeny shows overlap between species, this reduces the capacity of the molecular data to confidently distinguish between those species. In some cases, we may see the query sequence falling outside of the adjacent species' clades, which indicates that our query species is not represented in the reference database, which could indicate a rare or novel species.
The following resources can be used to ensure that the given taxonomy is legitimate and current.
| Taxa | Database |
|---|---|
| General | GBIF |
| General | ITIS |
| Mealybugs & scale | ScaleNet database |
| Thrips | Thripswiki |
| Spider Mites | Spider Mites Database |
| Psocodea (Barklice, Booklice, and Parasitic Lice) | Psocodea Species File Online |
| Orthoptera | Orthoptera Species File Online |
| Drosophilidae | TaxoDros |
| Diptera |
Catalog of the Diptera of the Australasian and Oceanian Regions
Systema Dipterorum |
| Aphids | Aphid Species File |
| Ants |
AntWeb
AntCat |
| Lepidoptera (butterflies and moths) | The Global Lepidoptera Names Index |
| Gracillariidae (primitive moths) | Global Taxonomic Database of Gracillariidae |
| Pyralidae (pyralid moths) | Global Information System on Pyraloidea |
| Tortricidae (tortrix moths) | Tortricidae Resources on the Net |